Why do male Parsons look so much like male Fischers?

SaintJimmy

Avid Member
I noticed this while browsing google images.

tumblr_lxnxsvb7611r9m5v7o1_1280.jpg


Parsons^

images


Fischers^
 

SaintJimmy

Avid Member
I don't think that is real. Looks photoshopped! Are you joking?

I've spent over 6 years with photoshop and other image editing software (gimp, corefx, sai, photoshop to name a few) and this doesnt look edited.

Maybe the contrast/brightness on the first one but I can't really find a bad spot in that image


I meant by the front horns. Why do the front horns look the same on both species?
 

carol5208

Chameleon Enthusiast
IDK I guess he just has a very pronounced rostral. I don't know much about Parsons so maybe someone else can comment.
 

Solid Snake

Avid Member
Why?

Because: augucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acuggucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcuagcugaugcuagucgaucguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
 

Vicky

New Member
Why?

Because: augucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acuggucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcuagcugaugcuagucgaucguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu

I think you have virus in your computer!
 

Motherlode Chameleon

Chameleon Enthusiast
I don't think that is real. Looks photoshopped! Are you joking?

I believe that is a Calumma parsonii cristifer. I'm sure someone with more knowledge will chime in.

That is a picture of a Calumma parsonii cristifer and Kinyongia matchiei. There are some similarities between the two and no those two pictures appear not to be photoshopped. The sub species of Parsonii has got some similarities to Kinyongia matschiei however Calumma parsonii parsonii is not similar to Kinyongia maschiei. Calumma parsonii cristifer is a mid sized chameleon similar to Kinyongia matchiei, along with there roastral blades are somewhat similar. I have not got my morphology books out meaning I'm going to stop comparing similarities to the two there. However the major differences between the two in regards to IDing is that Calumma parsonii cristifer does have a bigger body while Kinyongia matchiei has a much longer tail.
 
Last edited:

Ventari

New Member
Why?

Because: augucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acuggucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcuagcugaugcuagucgaucguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu

i believe your the person to ask the genetic code of the african swallow
 

Julija

New Member
Why?

Because: augucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acuggucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcuagcugaugcuagucgaucguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu

Solid Snake, I bow my head for you! :D

First I was like - what the hell??... But then realised that you said what I was thinking, just in a much sharper and smarter way! I could not stop laughing once I got it :)

To the OP: well, the obvious answer is - because they are all chameleons, aren't they? ;)
 

mcanham

Member
Why?

Because: augucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acuggucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuacugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcuagcugaugcuagucgaucguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu
acugcuagacugcugcuguagugcugaugugugggggugcuguagucgugaugucguagugucguagugcugaugugugcggaugucguagugcugugugaugugcgagggcugauguuuaucguagucguagugaucguagucguagugaugugcuguagugugucgugugauguaguagucguagucgugaugcugaugcuguaguguguagucguagucguagucgugauguagucguagugugcguagugcugaugcuguagcugaugcugaugcugaugcugaucguagugcugaucguguaguagcuagucugaugcugucaucguagcuagcugaugcuagucgaucguagcu

Your missing a very important nitrogenous base. "thymine" Creative way to answer a question.:) Unless that what the code for the RNA strand.
 

Solid Snake

Avid Member
Your missing a very important nitrogenous base. "thymine" Creative way to answer a question.:) Unless that what the code for the RNA strand.

The RNA strand that creates the expression of the rostal blade gene, which makes them look "similar" ;)
 

SaintJimmy

Avid Member
No he has a virus in his head some days.:) He even speaks Laurie and very few can do that.

Ah I guess I am one of the few. I've talked to you before :p

"Why do male Parsons look so much like male Fischers?"


To keep female Parsons and Fishers confused ;) :rolleyes:

Hahaha don't they live on like opposite sides of the world?

The RNA strand that creates the expression of the rostal blade gene, which makes them look "similar" ;)

Well played! I didn't get it at first
 
Top Bottom